GENETIC ASSIGNMENT (MSc) MASTERS PROGRAM please read attached instructions
- Details
- Hits: 22754
GENETIC ASSIGNMENT (MSc) MASTERS PROGRAM please read attached instructions.
ANSWERS needs not to be more than 2 pages long .THANK YOU
501. Name________________________________________________________
To be completed and emailed back to me by 5/22 @6:00PM. Anything later will not be accepted under any circumstances. Early submissions receive 3 extra credit points.
I. Of the following nine scenarios, answer all including part ii. No reply need be longer than 2 pages at most but every answer should be more than half a page at least. Some obviously require more work than others. (15 points each, 75 points in total.)
1.) Scenario: Kim Kardashian gets a subscription to Nature Magazine, the top-ranked science journal. She reads that a Chinese researcher has isolated an allele in a mouse model called ‘tiny b’, whose pseudogenization due to transposition resulted in a LOF mouse phenotype with greatly reduced buttocks. She hypothesizes that if this is the case, the wildtype allele in its original position must promote the growth of mouse buttocks. Kim wonders if this could a permanent solution for safely enhancing her figure. You, being a modern genetics counselor making $500 per hour, have been called in to advise her on tiny b function given your understanding of NCBI, RNAi, CRISPR, genetic engineering, transposons, and epigenetics and methylation. What will be your advice?
Start of your answer: “A superb idea, Mrs. West! This is what we are going to do…” OR “Are you OD crazy, girlfriend? Don’t even go there because…”
2.) Scenario: Imagine Chris Brown is a molecular doctoral student and his mentor, Dr. Jennifer Doudna, tells him at lunch time that she’s been selected to serve on a committee reviewing a proposal entitled ‘Exploring Diversity in the Protists’. The principle investigator (PI) from the proposal believes he has isolated gDNA from an unknown organism found as loose DNA in oceanic water, whose sequence is shown below. The PI is requesting $500,000 to continue his research. Dr. Doudna wants Chris to give her his opinion in 15 minutes over the integrity of the proposal since she’s too busy to look over it herself. Perform any requested tasks and answer the questions to help Chris and Dr. Doudna reach a decision.
5’CCCGCGCCACATTAAGCTCTATCATTGTCATCATATAATCTGATTACATGATGCCT
CAGCCCGTAGAGTAAGCGGCTCTTATAATAGC3’
a.) Q: Dr. Doudna wants to know the relevance of the genetic sequence the PI has listed. Is it gDNA, a gene, or a gene fragment? It seems brief: what Domain does it belong to based on any motifs that might positionally corroborate your assumption?
b.) Q: Bidirectionality of promoters occurs in some organisms whereas others can sequence both strands of DNA. Do you see any evidence of that here? If so, where?
c.) Q: Dr. Doudna wonders what type of sequencing method the PI is using since he is asking for a lot of money. Since Chris is going to have to look through 75 pages of the proposal, scanning for key words will speed up his search: do you think the PI used the Sanger technique, Illumina, or 454 pyrosequenching? Explain your response.
d.) Q: Dr. Doudna wants to know if Chris would fund this proposal as is. Check the most suitable answer and justify it with a short disclaimer or affirmation.
A: _____Heck nah! He stupid! He needs to _______________________
A: _____Heck yay! He smart! This is clever because ___________________
3.) Scenario: The nematode, Caenorhabditis elegans, is the major model organism for studies of longevity. Typically living for 14 days, they can begin reproducing around day 4. You hypothesize that speeding up their time to sexual maturity would allow researchers the ability to more quickly score novel phenotypes following breeding trials. After two years of research, your approach is to edit the nematode’s entire genome so that it lacks any introns whatsoever. This allows it to synthesize its DNA in minutes, versus hours, so that it now has the ability to grow at an exceptionally fast rate, and without any interruption in its protein coding genes. However, your genetically engineered nematode offspring start dying off at day two, succumbing to viral infections to which they were previously immune. Why? What happened?
4.) Scenario: Suppose the NASA Mars rover brings back a genomic sample from a frozen organism that contains DNA-like nucleotides. Just as on our planet, it appears it was to be transcribed into mRNA-like molecules. Unlike our DNA, however, it only used three bases (A, C, and T). A proteomic analysis revealed that out of all of its proteins, they could identify 38 different types of amino acids. If this is so, what is the minimum number of N bases likely to be in its codons? State your answer and explain it in a few sentences and show your calculations.
5.) Scenario: You make a $1000 bet with your good friend, Justin Bieber, that you are mad smart when it comes to genomics work since you have chosen to explore the effects of the transcription factor FOXP2 gene (e.g. CAGH44) in an Arabidopsis model, which he thinks is moronic. Justin asks you to explain how collinearity, synteny, C-content, BLAST, and gene homology influenced your model choice. Knowing all those terms and technologies, what would be your reply? Will you be laughing all the way to the bank over your bet or does Justin have the receipts on you this time?
6.) Scenario: Personalized medicine is the basis for continuing research in GWAS, which are expensive and time-consuming. After reading the review on the CAMERA system developed by Yang and Liu (reference = Ho and Bennett. 2018. Improved memory devices for synthetic cells. Science 360(6385): 150-151, http://science.sciencemag.org/content/360/6385/150), explain how their invention could be employed as treatment to address the opioid crisis plaguing the United States
7.) Scenario: In a quest for the Nobel, you decide to engineer a bigenic operon into a blue crab to address their population decline. Crabs typically move backward to escape danger when sea birds pursue them leaving their formidable claws facing forwards towards their predator. Your plan is to produce another set of eyes on the rear end of the crab so it can see the direction it is fleeing in. Using appropriate toolkit genes and your knowledge of collinearity, embryology, morphogenesis, and knock technology, explain your approach. (This will require an outside search for gene choices.)
8.) Scenario: Taylor Swift decides to start chilling with Cardi B in an attempt to increase her street cred. The two get into a heated argument over the one gene/one polypeptide hypothesis, which Taylor is in complete agreement since she says Beadle and Tatum already showed that every eukaryotic gene produces a single transcript that can only code for a single protein. Having a vast knowledge of protein synthesis, secondary structure in RNA, and pre’/co’/post-transcriptional modifications, Cardi has no time for fools and tells Taylor she can think of at least 8 different ways that a single transcript would result in multiple proteins. What’s on Cardi’s mind?
9.) Scenario: It’s 2028 and Lady Gaga’s music career has tanked so her little monsters convince her to get a master’s degree in Public Health so she can work for the CDC in Atlanta. Her assignment for her thesis is to track the Sleeping Beauty transposable element (e.g. SLPINGB), which was used experimentally four decades earlier as a fish non-viral vector to carry in beneficial alleles for genetic engineering for treatment of monogenic disorders in children. Unfortunately, the Beauty reawoke, appearing inside the hemoglobin gene so now Gaga is tracking its prevalence in post-mortem human genomes provided by J. Craig Ventor. She examines 1,225 hgenomes of people who received the treatment and finds it inserted into Hb alleles in two forms, a non-methylated version that inserted into wt Hb, and a hypermethylated version that inserted into HbS. The HbSSLPNGB version allowed 58 patients who developed sickle cell anemia to live until age 30, but was fatal within 120 days in 61% of the study population who had both wt HbSLPINGB alleles. A third segment of the study population managed to live until age 20 suggesting since the HbS allele’s version of SLPINGB was less problematic. Answer the following three questions:
a.) Using HWE, calculate how many members of Gaga’s study population were carriers?
b.) Considering the mobile element, what possible reason(s) allowed HbSSLPINGB patients to live longer?
c.) If SLPINGB was a retrotransposon, would it lead to genomic rearrangements, an increase in genome size, both, or neither?
II. Everyone must do this task! Being a whiz with systematics, NCBI, Newick files, and cladogram building, you will produce a phylogenetic tree to interpret. (25 points.)
Scenario: Leonotis is a charismatic bird-pollinated plant from Sub-Saharan Africa with large, scentless, tubular, orange flowers. It is closely related to Leucas and Acrotome, two insect-pollinated plants with small, sweetly-scented, white flowers. Using NCBI, search for a single fast-evolving marker system for Leonotis leonurus, L. nepetifolia, L. ocymifolia var. schinzii. L. ocymifolia var. ocymifolia, L. myrothamnifolia, L. grandis, Leucas capensis, Leucas martinicensis, and Acrotome hispida and A. pallescens. Once you find a single marker shared by all ten taxa, produce a FASTA file. Import it into trex.uqma.ca to produce a Newick file, which you will import to Phylodendron (via ‘Indiana tree app’) to produce a phaenogram. Paste all these elements into your answer sheet (FASTA, Newick, phaenogram) and interpret the resultant resolution. Do you think Leonotis is a natural group (e.g. monophyletic, arising from a single common ancestor) or do you think it is non-monophyletic? Leonotis has been noted for antimicrobial properties; considering that the three taxa share overlapping ranges, if you needed to preserve germplasm of Leonotis for medical studies, would you recommend in situ conservation efforts or ex situ? Explain.
ORDER AN ORIGINAL PAPER NOW